Sequence ID | >WENV170704933 |
Genome ID | LLEN01018465 |
Phylum/Class | [LLEN] bioreactor metagenome; day86 10degC chemostat 2012 inoculated with Wadden Sea sediment taken from the upper 2 cm of the |
Species | |
Start position on genome | 105 |
End posion on genome | 194 |
Amino Acid | Ser |
Anticodon | GGA |
Upstream region at tRNA start position |
acgggtcggc |
tRNA gene sequence |
GGAGAGGTGGCCGAGTGGTCGAAGGCGCACGCCTGGAAAGTGTGTAGGCGGGTGACCGTC |
Downstream region at tRNA end position |
ttatcttctt |
Secondary structure (Cloverleaf model) | >WENV170704933 Ser GGA c GCCA ttatcttctt G - C G - C A - T G - C A - T G - C G - C T A T T T C C C A T G A G + | | | | G G G C C G G A G G G C G | | | T T T A G G C C G A G TAGGCGGGTGACCGTCTC C - G A - T C - G G + T C - G C A T A G G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |