Sequence ID | >WENV170705026 |
Genome ID | LLEO01003178 |
Phylum/Class | [LLEO] bioreactor metagenome; day35 25degC chemostat 2012 inoculated with Wadden Sea sediment taken from the upper 2 cm of the |
Species | |
Start position on genome | 218 |
End posion on genome | 144 |
Amino Acid | Gln |
Anticodon | TTG |
Upstream region at tRNA start position |
agagcaatgt |
tRNA gene sequence |
AGGGCTATCGCCAAGCGGTAAGGCAGCGGCTTTTGATGCCGCCATTCCCTGGTTCGAATC |
Downstream region at tRNA end position |
catacaatga |
Secondary structure (Cloverleaf model) | >WENV170705026 Gln TTG t GCCA catacaatga A - T G - C G - C G - C C - G T - A A - T T A T G G A C C A G A C | | | | | G C A C C G C C T G G C G | | | T T G A G G C T A A CATTC G - C C - G G - C G - C C - G T T T A T T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |