Sequence ID | >WENV170705066 |
Genome ID | LLEP01000008 |
Phylum/Class | [LLEP] bioreactor metagenome; day64 25degC chemostat 2012 inoculated with Wadden Sea sediment taken from the upper 2 cm of the |
Species | |
Start position on genome | 12230 |
End posion on genome | 12316 |
Amino Acid | Leu |
Anticodon | GAG |
Upstream region at tRNA start position |
agacagttat |
tRNA gene sequence |
GCGGTCGTGGCGGAATTGGTAGACGCGCAGCGTTGAGGTCGCTGTGGGGTAACACCCGTG |
Downstream region at tRNA end position |
aactgtttta |
Secondary structure (Cloverleaf model) | >WENV170705066 Leu GAG t ACCA aactgtttta G - C C - G G - C G - C T - A C - G G - C T G T T C T T C A T A A G + | | | | G T G G C G G G A A G C G | | | T T G A C G C T A G G TGGGGTAACACCCGT C - G A - T G - C C - G G - C T T T G G A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |