Sequence ID | >WENV170705169 |
Genome ID | LLEP01015203 |
Phylum/Class | [LLEP] bioreactor metagenome; day64 25degC chemostat 2012 inoculated with Wadden Sea sediment taken from the upper 2 cm of the |
Species | |
Start position on genome | 44 |
End posion on genome | 133 |
Amino Acid | Ser |
Anticodon | GCT |
Upstream region at tRNA start position |
acgggtcgac |
tRNA gene sequence |
GGAGACGTGGCCGAGTGGTCGAAGGCGCTCCCCTGCTAAGGGAGTAGGCGGGAAACCGTC |
Downstream region at tRNA end position |
caatcccctt |
Secondary structure (Cloverleaf model) | >WENV170705169 Ser GCT c GCCA caatcccctt G - C G - C A - T G - C A - T C - G G - C T A T T T C C C A T G A G + | | | | G G G C C G G A G G G C G | | | T T T A G G C C G A G TAGGCGGGAAACCGTCTC C - G T - A C - G C - G C - G C A T A G C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |