Sequence ID | >WENV170705243 |
Genome ID | LLEQ01001211 |
Phylum/Class | [LLEQ] bioreactor metagenome; day86 25degC chemostat 2012 inoculated with Wadden Sea sediment taken from the upper 2 cm of the |
Species | |
Start position on genome | 2773 |
End posion on genome | 2699 |
Amino Acid | Val |
Anticodon | CAC |
Upstream region at tRNA start position |
ccccggcaac |
tRNA gene sequence |
GGGTGATTAGCTCAGTGGTAGAGCGCTTCGTTCACATCGAAGATGTCAGGAGTTCAAATC |
Downstream region at tRNA end position |
tttaaagcga |
Secondary structure (Cloverleaf model) | >WENV170705243 Val CAC c ACCA tttaaagcga G - C G - C G - C T - A G - C A - T T - A T A T T T C T C A G A A | + | | | A T C T C G A G G A G C G | | | | T T G G A G C T A G ATGTC C - G T - A T - A C - G G - C T T T A C A C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |