Sequence ID | >WENV170705248 |
Genome ID | LLEQ01001323 |
Phylum/Class | [LLEQ] bioreactor metagenome; day86 25degC chemostat 2012 inoculated with Wadden Sea sediment taken from the upper 2 cm of the |
Species | |
Start position on genome | 1137 |
End posion on genome | 1210 |
Amino Acid | Gly |
Anticodon | CCC |
Upstream region at tRNA start position |
aggcgccatc |
tRNA gene sequence |
GCGGGTGTAGCTCAATGGTAGAGCAGCAGCTTCCCAAGCTGAATACGAGGGTTCGATTCC |
Downstream region at tRNA end position |
atcctccaaa |
Secondary structure (Cloverleaf model) | >WENV170705248 Gly CCC c TCCA atcctccaaa G - C C - G G - C G - C G - C T - A G - C T T T T T C C C A A A A + | | | | G T C T C G G A G G G C G | | | | T T G G A G C T A A ATAC G A C - G A - T G - C C - G T A T A C C C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |