Sequence ID | >WENV170705373 |
Genome ID | LLEQ01025710 |
Search identical group | |
Phylum/Class | [LLEQ] bioreactor metagenome; day86 25degC chemostat 2012 inoculated with Wadden Sea sediment taken from the upper 2 cm of the |
Species | |
Start position on genome | 161 |
End posion on genome | 86 |
Amino Acid | Glu |
Anticodon | TTC |
Upstream region at tRNA start position |
gaaacactta |
tRNA gene sequence |
GTCCCGTTCGTCTAGAGGCCTAGGACACCGCCCTTTCACGGCGGTAACAGGGGTTCGACT |
Downstream region at tRNA end position |
agggtcgtta |
Secondary structure (Cloverleaf model) | >WENV170705373 Glu TTC a GCCA agggtcgtta G - C T - A C - G C - G C - G G - C T - A T C T T C C C C A A G A C | | | | | G G T C T G A G G G G C G + | | | T T C G G A C C T A A TAAC C - G C - G G - C C - G C - G C C T A T T C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |