Sequence ID | >WENV170706339 |
Genome ID | LNAP01002248 |
Search identical group | |
Phylum/Class | [LNAP] soil metagenome; Soil samples (1 kg each in a 20% v/v slurry with milli Q water) were incubated in the dark with |
Species | |
Start position on genome | 2941 |
End posion on genome | 3025 |
Amino Acid | Leu |
Anticodon | GAG |
Upstream region at tRNA start position |
agctggttta |
tRNA gene sequence |
GCCGACGTGGTGGAATTGGTAGACACGCTATCTTGAGGGGGTAGTGGCGAAAGCTGTGCG |
Downstream region at tRNA end position |
agaattgcag |
Secondary structure (Cloverleaf model) | >WENV170706339 Leu GAG a ACCA agaattgcag G - C C - G C - G G - C A - T C - G G - C T G T C G C T C A T A A G | | | | | G T G G T G G C G A G C G | | | T T G A C A C T A G G TGGCGAAAGCTGT C - G T - A A - T T + G C - G T G T G G A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |