Sequence ID | >WENV170706905 |
Genome ID | LNAP01008749 |
Search identical group | |
Phylum/Class | [LNAP] soil metagenome; Soil samples (1 kg each in a 20% v/v slurry with milli Q water) were incubated in the dark with |
Species | |
Start position on genome | 6446 |
End posion on genome | 6373 |
Amino Acid | Cys |
Anticodon | GCA |
Upstream region at tRNA start position |
gcccttacgg |
tRNA gene sequence |
GGCCACGTGGCGGAGTGGTTACGCGCCGGTCTGCAAAACCGTTTACTCGGGTTCGAGTCC |
Downstream region at tRNA end position |
tcatagatat |
Secondary structure (Cloverleaf model) | >WENV170706905 Cys GCA g TCCA tcatagatat G - C G - C C - G C - G A - T C - G G - C T G T A G C C C A G A G | | | | | G T G G C G T C G G G C G | | | T T G A C G C T T G TTAC C T C - G G - C G - C T - A C A T A G C A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |