Sequence ID | >WENV170707006 |
Genome ID | LNAP01010782 |
Search identical group | |
Phylum/Class | [LNAP] soil metagenome; Soil samples (1 kg each in a 20% v/v slurry with milli Q water) were incubated in the dark with |
Species | |
Start position on genome | 6954 |
End posion on genome | 7030 |
Amino Acid | Arg |
Anticodon | TCT |
Upstream region at tRNA start position |
ggctccagac |
tRNA gene sequence |
GGTCCCGTAGCTCAACTGGATAGAGCATCAGATTTCTACTCTGAGGGTTGCAGGTTCGAT |
Downstream region at tRNA end position |
gccnnnnnnn |
Secondary structure (Cloverleaf model) | >WENV170707006 Arg TCT c GCCA gccnnnnnnn G - C G + T T - A C - G C - G C - G G - C T T T C G T C C A C A A A | | | | | G T C T C G G C A G G C G | | | | T T G G A G C A T A A GGGTT T - A C - G A - T G - C A - T T C T A T C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |