Sequence ID | >WENV170707311 |
Genome ID | LNAP01016982 |
Search identical group | |
Phylum/Class | [LNAP] soil metagenome; Soil samples (1 kg each in a 20% v/v slurry with milli Q water) were incubated in the dark with |
Species | |
Start position on genome | 1347 |
End posion on genome | 1273 |
Amino Acid | Gln |
Anticodon | TTG |
Upstream region at tRNA start position |
ttcactttat |
tRNA gene sequence |
TGGGGCGTCGCCAAGCGGTAAGGCACCGGATTTTGATTCCGGCATTCCCAGGTTCGATCC |
Downstream region at tRNA end position |
tatcccagta |
Secondary structure (Cloverleaf model) | >WENV170707311 Gln TTG t GCCA tatcccagta T - A G - C G - C G - C G - C C - G G - C C T T G G T C C A G A C | | | | | G C A C C G C C A G G C G | | | T T G A G G C T A A CATTC C - G C - G G - C G - C A - T T T T A T T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |