Sequence ID | >WENV170707312 |
Genome ID | LNAP01017079 |
Search identical group | |
Phylum/Class | [LNAP] soil metagenome; Soil samples (1 kg each in a 20% v/v slurry with milli Q water) were incubated in the dark with |
Species | |
Start position on genome | 333 |
End posion on genome | 408 |
Amino Acid | Lys |
Anticodon | TTT |
Upstream region at tRNA start position |
gcggccatgg |
tRNA gene sequence |
GAGCGCGTAGCTCAGCCGGTAGAGCACGTGACTTTTAATCACGGGGTCCTGGGTTCGAGC |
Downstream region at tRNA end position |
aataagacca |
Secondary structure (Cloverleaf model) | >WENV170707312 Lys TTT g ACCA aataagacca G - C A - T G - C C - G G - C C - G G - C C G T G A C C C A C G A A | | | | | G C C T C G C T G G G C G | | | | T T G G A G C T A A GGGTC C - G G - C T - A G - C A - T C A T A T T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |