Sequence ID | >WENV170707833 |
Genome ID | LNAP01035908 |
Search identical group | |
Phylum/Class | [LNAP] soil metagenome; Soil samples (1 kg each in a 20% v/v slurry with milli Q water) were incubated in the dark with |
Species | |
Start position on genome | 17 |
End posion on genome | 92 |
Amino Acid | Ala |
Anticodon | CGC |
Upstream region at tRNA start position |
ccggccccac |
tRNA gene sequence |
GGGGCCATAGCTCAGCTGGGAGAGCGCGTCGTTCGCAATGACGAGGTCGGGAGTTCGATC |
Downstream region at tRNA end position |
ccgtttttga |
Secondary structure (Cloverleaf model) | >WENV170707833 Ala CGC c ACCA ccgtttttga G - C G - C G + T G - C C - G C - G A - T C T T C C C T C A C G A A | | | | | G T C T C G G G G A G C G | | | | T T G G A G C G A G AGGTC C - G G - C T - A C - G G + T T A T A C G C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |