| Sequence ID | >WENV170708091 |
| Genome ID | LNAP01049612 |
| Phylum/Class | [LNAP] soil metagenome; Soil samples (1 kg each in a 20% v/v slurry with milli Q water) were incubated in the dark with |
| Species | |
| Start position on genome | 227 |
| End posion on genome | 311 |
| Amino Acid | Leu |
| Anticodon | CAA |
| Upstream region at tRNA start position |
tacaatcaat |
| tRNA gene sequence |
GCCCAGATGGCGGAATTGGTAGACGCGCTGGTCTCAAACACCAGTGGATTCACTTCCATG |
| Downstream region at tRNA end position |
gtaaataatc |
| Secondary structure (Cloverleaf model) | >WENV170708091 Leu CAA
t ACac gtaaataatc
G + T
C - G
C - G
C - G
A - T
G - C
A - T C T
T C G G C C A
T A A G | | | | | G
T G G C G G C C G G C
G | | | T T
G A C G C
T A G G TGGATTCACTTCCAT
C - G
T - A
G - C
G - C
T - A
C C
T A
C A A
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |