Sequence ID | >WENV170708728 |
Genome ID | LNAQ01000298 |
Search identical group | |
Phylum/Class | [LNAQ] soil metagenome; soil samples (1 kg each in a 20% v/v slurry with milli Q water) were incubated in the dark with |
Species | |
Start position on genome | 8109 |
End posion on genome | 8033 |
Amino Acid | Arg |
Anticodon | ACG |
Upstream region at tRNA start position |
gacctctcta |
tRNA gene sequence |
GCGCCCGTAGCTCATCTGGATAGAGTACTTGGCTACGAACCAAGGGGTAGGGAGTTCGAA |
Downstream region at tRNA end position |
aaaaacaatg |
Secondary structure (Cloverleaf model) | >WENV170708728 Arg ACG a ACCA aaaaacaatg G - C C - G G - C C - G C - G C - G G - C T A T C T C T C A C T A A | + | | | G T C T C G G G G A G C G | | | + T T G G A G T A T A A GGGTA C - G T - A T - A G - C G - C C A T A A C G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |