Sequence ID | >WENV170710272 |
Genome ID | LNFM01001423 |
Search identical group | |
Phylum/Class | [LNFM] activated carbon metagenome; dual media filters at the Ann Arbor, Michigan drinking water treatment plant |
Species | |
Start position on genome | 10161 |
End posion on genome | 10237 |
Amino Acid | Pro |
Anticodon | GGG |
Upstream region at tRNA start position |
cgcccacggt |
tRNA gene sequence |
CGGGGCGTAGCGCAGCCCGGTAGCGCATCAGTCTGGGGGACTGGGGGTCGTGGGTTCGAA |
Downstream region at tRNA end position |
acaaatccag |
Secondary structure (Cloverleaf model) | >WENV170710272 Pro GGG t ACCA acaaatccag C - G G - C G - C G - C G - C C - G G - C T A T C G C C C A C G A A | + | | | G C C G C G G T G G G C C | | | | T T G G C G C G T A A GGGTC T + G C - G A - T G - C T - A C G T G G G G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |