Sequence ID | >WENV170710430 |
Genome ID | LNFM01001736 |
Search identical group | |
Phylum/Class | [LNFM] activated carbon metagenome; dual media filters at the Ann Arbor, Michigan drinking water treatment plant |
Species | |
Start position on genome | 9 |
End posion on genome | 85 |
Amino Acid | Met |
Anticodon | CAT |
Upstream region at tRNA start position |
nnaccatccc |
tRNA gene sequence |
CGCGGGATGGAGCAGCCCGGTAGCTCGTCAGGCTCATAACCTGAAGGTCGCAGGTTCAAA |
Downstream region at tRNA end position |
catcaccacc |
Secondary structure (Cloverleaf model) | >WENV170710430 Met CAT c ACCA catcaccacc C A G - C C - G G - C G - C G - C A - T T A T C G T C C A C G A G | | | | | A C C G A G G C A G G C C | | | | T T G G C T C G T A G AGGTC T - A C - G A - T G - C G - C C A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |