Sequence ID | >WENV170712874 |
Genome ID | LNFM01019230 |
Search identical group | |
Phylum/Class | [LNFM] activated carbon metagenome; dual media filters at the Ann Arbor, Michigan drinking water treatment plant |
Species | |
Start position on genome | 7088 |
End posion on genome | 7163 |
Amino Acid | Met |
Anticodon | CAT |
Upstream region at tRNA start position |
tccccatatc |
tRNA gene sequence |
GGGCCCATAGCTCAGCGGTCAGAGCCGCCGGCTCATAATCGGTTGGACCCAGGTTCGAAT |
Downstream region at tRNA end position |
ctcctcgcgg |
Secondary structure (Cloverleaf model) | >WENV170712874 Met CAT c ACCA ctcctcgcgg G - C G - C G - C C - G C - G C - G A - T T A T G G T C C A C G A A | | | | | G G C T C G C C A G G C G | | | | T T T G A G C C A C TGGAC G + T C - G C - G G - C G + T C A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |