Sequence ID | >WENV170715233 |
Genome ID | LNQE01000935 |
Search identical group | |
Phylum/Class | [LNQE] hydrocarbon metagenome; hydrocarbon-contaminated ditch |
Species | |
Start position on genome | 2803 |
End posion on genome | 2889 |
Amino Acid | Leu |
Anticodon | CAG |
Upstream region at tRNA start position |
tctctcaagt |
tRNA gene sequence |
GCCGAAGTGGCGGAATTGGTAGACGCGCTAGGTTCAGGGTCTAGTGGGCGTGCGCCTGTC |
Downstream region at tRNA end position |
tttgtgaaaa |
Secondary structure (Cloverleaf model) | >WENV170715233 Leu CAG t ACCA tttgtgaaaa G - C C - G C - G G - C A - T A - T G - C T A T G G C C C A T A A G | | | | | A T G G C G C C G G G C G | | | T T G A C G C T A G G TGGGCGTGCGCCTGT C - G T - A A - T G - C G + T T G T G C A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |