Sequence ID | >WENV170715457 |
Genome ID | LQAB01001121 |
Search identical group | |
Phylum/Class | [LQAB] termite gut metagenome; bacterial endosymbionts found in Trichonympha flagellates filtered from termite gut |
Species | |
Start position on genome | 12797 |
End posion on genome | 12722 |
Amino Acid | Glu |
Anticodon | CTC |
Upstream region at tRNA start position |
tttagaaaat |
tRNA gene sequence |
GGTCCTATCGTCTAGTGGCCTAGGATATCGCCCTCTCACGGCGGAGACACGGGTTCGAAC |
Downstream region at tRNA end position |
taaaatcaac |
Secondary structure (Cloverleaf model) | >WENV170715457 Glu CTC t GCCA taaaatcaac G + T G - C T - A C - G C - G T + G A - T C A T T G C C C A T G A C | | | | | G G T C T G A C G G G C G + | | + T T C G G A T C T A A AGAC T + G C - G G - C C - G C - G C C T A C T C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |