Sequence ID | >WENV170715494 |
Genome ID | LQAB01002449 |
Search identical group | |
Phylum/Class | [LQAB] termite gut metagenome; bacterial endosymbionts found in Trichonympha flagellates filtered from termite gut |
Species | |
Start position on genome | 1361 |
End posion on genome | 1276 |
Amino Acid | Leu |
Anticodon | CAA |
Upstream region at tRNA start position |
atatctttaa |
tRNA gene sequence |
GCCGGGGTGGTGGAATTGGCAGACACGTGAGACTCAAAATCTCAAGTTGCTTAGGCGACG |
Downstream region at tRNA end position |
tataaatttc |
Secondary structure (Cloverleaf model) | >WENV170715494 Leu CAA a Ataa tataaatttc G - C C - G C - G G - C G + T G - C G - C T G T C G C C C A T A A G | | | | | A T G G T G G C G G G C G | | | T T G A C A C C A G G AGTTGCTTAGGCGACGT T - A G - C A - T G - C A - T C A T A C A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |