Sequence ID | >WENV170716573 |
Genome ID | LSQX01004251 |
Phylum/Class | [LSQX] anaerobic digester metagenome; 4 biogas reactors fed with cattle manure at either 37C or 55C with and without the addition |
Species | |
Start position on genome | 2252 |
End posion on genome | 2178 |
Amino Acid | Cys |
Anticodon | GCA |
Upstream region at tRNA start position |
ttttgttttc |
tRNA gene sequence |
GGCGCCATAGCCAAGTGGTAAGGCAGAGGCCTGCAAAGCCTTTATCCCCCGGTTCAAATC |
Downstream region at tRNA end position |
taaaagaaca |
Secondary structure (Cloverleaf model) | >WENV170716573 Cys GCA c TCCA taaaagaaca G - C G - C C - G G - C C - G C - G A - T T A T G G G C C A G A A | | | | | A T A C C G C C C G G C G | | | T T G A G G C T A A TATCC G + T A - T G - C G - C C - G C A T A G C A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |