Sequence ID | >WENV170716597 |
Genome ID | LSQX01005074 |
Phylum/Class | [LSQX] anaerobic digester metagenome; 4 biogas reactors fed with cattle manure at either 37C or 55C with and without the addition |
Species | |
Start position on genome | 13672 |
End posion on genome | 13746 |
Amino Acid | Asn |
Anticodon | GTT |
Upstream region at tRNA start position |
aggcctacgc |
tRNA gene sequence |
TCCTCGGTAGCTCAATGGTAGAGCACCTGACTGTTAATCAGGGTGTTGCAGGTTCGAGTC |
Downstream region at tRNA end position |
tgtctccctc |
Secondary structure (Cloverleaf model) | >WENV170716597 Asn GTT c GCCA tgtctccctc T - A C - G C - G T - A C - G G - C G - C T G T C G T C C A A A A | | | | | G T C T C G G C A G G C G | | | | T T G G A G C T A A GTGTT C - G C - G T - A G - C A - T C A T A G T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |