Sequence ID | >WENV170716598 |
Genome ID | LSQX01005074 |
Phylum/Class | [LSQX] anaerobic digester metagenome; 4 biogas reactors fed with cattle manure at either 37C or 55C with and without the addition |
Species | |
Start position on genome | 14820 |
End posion on genome | 14905 |
Amino Acid | Leu |
Anticodon | GAG |
Upstream region at tRNA start position |
gctcactcgc |
tRNA gene sequence |
GTCCGAGTGGCGGAATTGGCAGACGCGCTAGGTTGAGGGCCTAGTGAGTGCATAACTCAT |
Downstream region at tRNA end position |
tccccctggt |
Secondary structure (Cloverleaf model) | >WENV170716598 Leu GAG c ACtc tccccctggt G - C T - A C - G C - G G - C A - T G - C T G T C G C C C A T A A G | | | | | A T G G C G G C G G G C G | | | T T G A C G C C A G G TGAGTGCATAACTCAT C - G T - A A - T G - C G - C T G T G G A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |