Sequence ID | >WENV170716681 |
Genome ID | LSQX01007843 |
Phylum/Class | [LSQX] anaerobic digester metagenome; 4 biogas reactors fed with cattle manure at either 37C or 55C with and without the addition |
Species | |
Start position on genome | 64907 |
End posion on genome | 64980 |
Amino Acid | Gln |
Anticodon | CTG |
Upstream region at tRNA start position |
cagatgatat |
tRNA gene sequence |
TGGGGAATGGTGCAACGGCAGCACGCCTGACTCTGGATCAGGTAATCCTGGTTCGAATCC |
Downstream region at tRNA end position |
gaaaacaagg |
Secondary structure (Cloverleaf model) | >WENV170716681 Gln CTG t GCCA gaaaacaagg T - A G - C G - C G - C G - C A - T A - T T A T G G A C C A A A G | | | | | G C C G T G C C T G G C G | | | | T T G G C A C C A G TAAT C - G C - G T - A G - C A - T C A T G C T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |