Sequence ID | >WENV170716683 |
Genome ID | LSQX01007843 |
Phylum/Class | [LSQX] anaerobic digester metagenome; 4 biogas reactors fed with cattle manure at either 37C or 55C with and without the addition |
Species | |
Start position on genome | 78992 |
End posion on genome | 78906 |
Amino Acid | Leu |
Anticodon | AAG |
Upstream region at tRNA start position |
ccgtcgttct |
tRNA gene sequence |
GCGGGGGTGGCGGAACGGGTAGACGCGCAAGGCTAAGGACCTTGTGGCCTCTGGGCTGTG |
Downstream region at tRNA end position |
tattgggttt |
Secondary structure (Cloverleaf model) | >WENV170716683 Leu AAG t ACCA tattgggttt G - C C - G G - C G - C G + T G - C G - C T G T C C C T C A C A A G | | | | | G G G G C G G G G A G C G | | | T T G A C G C T A G G TGGCCTCTGGGCTGT C - G A - T A - T G - C G - C C A T G A A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |