Sequence ID | >WENV170716725 |
Genome ID | LSQX01009735 |
Phylum/Class | [LSQX] anaerobic digester metagenome; 4 biogas reactors fed with cattle manure at either 37C or 55C with and without the addition |
Species | |
Start position on genome | 10575 |
End posion on genome | 10501 |
Amino Acid | Val |
Anticodon | CAC |
Upstream region at tRNA start position |
aaacaacagt |
tRNA gene sequence |
GGGCGACTAGCTCAGCGGGAGAGCGCTTCCCTCACACGGAAGAGGTCGCAGGTTCGAAAC |
Downstream region at tRNA end position |
ttttaatttc |
Secondary structure (Cloverleaf model) | >WENV170716725 Val CAC t ACCA ttttaatttc G - C G - C G - C C - G G - C A - T C - G A A T C G T C C A G A A | | | | | G C C T C G G C A G G C G | | | | T T G G A G C G A G AGGTC C - G T - A T - A C - G C - G C C T A C A C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |