Sequence ID | >WENV170716852 |
Genome ID | LSQX01014083 |
Phylum/Class | [LSQX] anaerobic digester metagenome; 4 biogas reactors fed with cattle manure at either 37C or 55C with and without the addition |
Species | |
Start position on genome | 27729 |
End posion on genome | 27654 |
Amino Acid | Met |
Anticodon | CAT |
Upstream region at tRNA start position |
aatttaatat |
tRNA gene sequence |
CGCGGGGTAGAGCAGTTGGTAGCTCGTCGGGCTCATAACCCGGAGGTCGCAGGTTCAAGT |
Downstream region at tRNA end position |
tttaacaaaa |
Secondary structure (Cloverleaf model) | >WENV170716852 Met CAT t ACCA tttaacaaaa C A G - C C - G G - C G - C G - C G - C T G T T G T C C A T G A A + | | | | A T C G A G G C A G G C G | | | | T T G G C T C T A G AGGTC T + G C - G G - C G - C G - C C A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |