Sequence ID | >WENV170717029 |
Genome ID | LSQX01021348 |
Phylum/Class | [LSQX] anaerobic digester metagenome; 4 biogas reactors fed with cattle manure at either 37C or 55C with and without the addition |
Species | |
Start position on genome | 5464 |
End posion on genome | 5376 |
Amino Acid | Ser |
Anticodon | CGA |
Upstream region at tRNA start position |
ttgtttctct |
tRNA gene sequence |
GGAGAAATACCCAAGAGGCTGAAGGGGTCGGTCTCGAAAACCGATAGGAGTGAAAGCTCG |
Downstream region at tRNA end position |
ctattcaaat |
Secondary structure (Cloverleaf model) | >WENV170717029 Ser CGA t GCCA ctattcaaat G - C G - C A - T G - C A - T A - T A - T T A T C T C C C A A G A A | | | | | A G A C C C G A G G G C G | | | T T C A G G G T G A G TAGGAGTGAAAGCTCGC T - A C - G G - C G - C T - A C A T A C G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |