Sequence ID | >WENV170717098 |
Genome ID | LSQX01024469 |
Phylum/Class | [LSQX] anaerobic digester metagenome; 4 biogas reactors fed with cattle manure at either 37C or 55C with and without the addition |
Species | |
Start position on genome | 14779 |
End posion on genome | 14871 |
Amino Acid | Ser |
Anticodon | CGA |
Upstream region at tRNA start position |
cgtaatgacg |
tRNA gene sequence |
GGAGAGGTGGCCGAGCGGTCGAAGGCGGTCGACTCGAAATCGACTAGGCGGTGATGAGCC |
Downstream region at tRNA end position |
tttaagaaat |
Secondary structure (Cloverleaf model) | >WENV170717098 Ser CGA g GCCA tttaagaaat G - C G - C A - T G - C A - T G - C G - C T A T C A C C C A C G A G | | | | | A G G C C G G T G G G C G | | | T T T A G G C C G A G TAGGCGGTGATGAGCCGTCTC G - C T - A C - G G - C A - T C A T A C G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |