Sequence ID | >WENV170717241 |
Genome ID | LSQX01028891 |
Phylum/Class | [LSQX] anaerobic digester metagenome; 4 biogas reactors fed with cattle manure at either 37C or 55C with and without the addition |
Species | |
Start position on genome | 39945 |
End posion on genome | 39864 |
Amino Acid | Tyr |
Anticodon | GTA |
Upstream region at tRNA start position |
tttatttcta |
tRNA gene sequence |
GGGGAGGTTCCCGAGCGGTCAAAGGGGGCAGACTGTAAATCTGTTGGCTAAGCCTTCGAA |
Downstream region at tRNA end position |
aggccttctt |
Secondary structure (Cloverleaf model) | >WENV170717241 Tyr GTA a Aaac aggccttctt G - C G - C G - C G - C A - T G - C G + T T A T C T T C C A C G A T | | | | | G G G C C C G A A G G C G | | | T C T A G G G C A A G TGGCTAAGCCTTC G + T C - G A - T G - C A - T C A T A G T A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |