Sequence ID | >WENV170717344 |
Genome ID | LSQX01032445 |
Phylum/Class | [LSQX] anaerobic digester metagenome; 4 biogas reactors fed with cattle manure at either 37C or 55C with and without the addition |
Species | |
Start position on genome | 1241 |
End posion on genome | 1155 |
Amino Acid | Leu |
Anticodon | GAG |
Upstream region at tRNA start position |
attctcatat |
tRNA gene sequence |
GCAGGGGTGGTCGAGCGGTCAAAGGCGCTAGGTTGAGGGCCTAGTGGGGGAGTCCCTTCG |
Downstream region at tRNA end position |
ttcaaatact |
Secondary structure (Cloverleaf model) | >WENV170717344 Leu GAG t ACTA ttcaaatact G - C C - G A - T G - C G - C G - C G - C T A T T G C C C A C G A G + | | | | G G G C T G G C G G G C G | + | T T T A G G C C A A G TGGGGGAGTCCCTTC C - G T - A A - T G - C G - C T G T G G A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |