Sequence ID | >WENV170717352 |
Genome ID | LSQX01032721 |
Phylum/Class | [LSQX] anaerobic digester metagenome; 4 biogas reactors fed with cattle manure at either 37C or 55C with and without the addition |
Species | |
Start position on genome | 31601 |
End posion on genome | 31675 |
Amino Acid | Glu |
Anticodon | TTC |
Upstream region at tRNA start position |
ggtctattgc |
tRNA gene sequence |
GGCCCATTGGTCAAGTGGTTAAGACATCGCCCTTTCACGGCGGTAACGAGGGTTCGAGTC |
Downstream region at tRNA end position |
ttccgaggtg |
Secondary structure (Cloverleaf model) | >WENV170717352 Glu TTC c ACCA ttccgaggtg G - C G + T C - G C - G C - G A - T T - A T G T C T C C C A T G A G | | | | | G G A C T G G A G G G C G | | | T T T A G A C T A A TAAC T + G C - G G - C C - G C - G C C T A T T C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |