Sequence ID | >WENV170717401 |
Genome ID | LSQX01034238 |
Phylum/Class | [LSQX] anaerobic digester metagenome; 4 biogas reactors fed with cattle manure at either 37C or 55C with and without the addition |
Species | |
Start position on genome | 1777 |
End posion on genome | 1691 |
Amino Acid | Leu |
Anticodon | GAG |
Upstream region at tRNA start position |
gtcgcacagT |
tRNA gene sequence |
GCGAGGGTAGCCAAGCCAGGTCAACGGCGCTAGCTTGAGGGGCTAGTCTAGTAGTAGTTC |
Downstream region at tRNA end position |
ggatgtgatg |
Secondary structure (Cloverleaf model) | >WENV170717401 Leu GAG T ATat ggatgtgatg G - C C - G G - C A - T G - C G - C G - C T A T T A C C C A C C G A A | | | | G A A C C G T T G G G C G | | | T T G C G G C T C A A G TCTAGTAGTAGTTC C - G T - A A - T G - C C - G T G T G G A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |