Sequence ID | >WENV170717523 |
Genome ID | LSQX01038754 |
Phylum/Class | [LSQX] anaerobic digester metagenome; 4 biogas reactors fed with cattle manure at either 37C or 55C with and without the addition |
Species | |
Start position on genome | 14708 |
End posion on genome | 14634 |
Amino Acid | Val |
Anticodon | GAC |
Upstream region at tRNA start position |
ttacccatgc |
tRNA gene sequence |
AGGCAAGTAGCTCAGGGGGAGAGCGCCATCCTGACGCGGTGGATGTCCAGGGTTCAAATC |
Downstream region at tRNA end position |
tttgtttgta |
Secondary structure (Cloverleaf model) | >WENV170717523 Val GAC c ACCA tttgtttgta A - T G - C G - C C - G A - T A - T G - C T A T G T C C C A G A A | | | | | A G C T C G C A G G G C G | | | | T T G G A G C G A G ATGTC C - G C - G A - T T + G C - G C C T G G A C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |