Sequence ID | >WENV170717569 |
Genome ID | LSQX01040804 |
Phylum/Class | [LSQX] anaerobic digester metagenome; 4 biogas reactors fed with cattle manure at either 37C or 55C with and without the addition |
Species | |
Start position on genome | 1506 |
End posion on genome | 1434 |
Amino Acid | Thr |
Anticodon | CGT |
Upstream region at tRNA start position |
taaggcagtt |
tRNA gene sequence |
GCCGCTGTGGCTTAGTGGTATAGCGGCTGATTCGTAATCAGCAGGCCGGGGGTTCGAATC |
Downstream region at tRNA end position |
cttcattttc |
Secondary structure (Cloverleaf model) | >WENV170717569 Thr CGT t TCtt cttcattttc G - C C - G C - G G - C C - G T - A G - C T A T C T C C C A G A G | + | | | G T T T C G G G G G G C G | | | T T G T A G C T A G AGGCC G - C C - G T - A G - C A - T T A T A C G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |