Sequence ID | >WENV170717628 |
Genome ID | LSQX01043407 |
Phylum/Class | [LSQX] anaerobic digester metagenome; 4 biogas reactors fed with cattle manure at either 37C or 55C with and without the addition |
Species | |
Start position on genome | 1356 |
End posion on genome | 1441 |
Amino Acid | Ser |
Anticodon | TGA |
Upstream region at tRNA start position |
aaatcgcctg |
tRNA gene sequence |
GGAGGGTTGTCCGAGCGGCCGAAGGATCTGGTCTTGAAAACCAGTGGGCAGCAATGTCCC |
Downstream region at tRNA end position |
catcctgaga |
Secondary structure (Cloverleaf model) | >WENV170717628 Ser TGA g GCat catcctgaga G - C G - C A - T G - C G - C G - C T + G T A T C A C C C A C G A G | | | | | G G G C C T G T G G G C G | | | T T C A G G A C G A T TGGGCAGCAATGTCCC C - G T - A G - C G - C T - A C A T A T G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |