Sequence ID | >WENV170717643 |
Genome ID | LSQX01044269 |
Phylum/Class | [LSQX] anaerobic digester metagenome; 4 biogas reactors fed with cattle manure at either 37C or 55C with and without the addition |
Species | |
Start position on genome | 7134 |
End posion on genome | 7063 |
Amino Acid | Cys |
Anticodon | GCA |
Upstream region at tRNA start position |
tgtggggcat |
tRNA gene sequence |
GCCAGGTTGGCGGAGTGGTAACGCGACTGCCTGCAGAGCAGTTCTACGCCTGTTCAATTC |
Downstream region at tRNA end position |
tccttttgga |
Secondary structure (Cloverleaf model) | >WENV170717643 Cys GCA t Ttat tccttttgga G - C C - G C - G A - T G - C G - C T - A T T T C G G A C A G A G | | | | | A T G G C G G C C T G C G | | | T T G A C G C T A G TCTAC A - T C - G T - A G - C C - G C A T G G C A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |