Sequence ID | >WENV170717798 |
Genome ID | LSQX01050003 |
Phylum/Class | [LSQX] anaerobic digester metagenome; 4 biogas reactors fed with cattle manure at either 37C or 55C with and without the addition |
Species | |
Start position on genome | 49251 |
End posion on genome | 49159 |
Amino Acid | Ser |
Anticodon | GCT |
Upstream region at tRNA start position |
ttttttcttt |
tRNA gene sequence |
GGAGATGTGGCCGAGAGGTTGAAGGTACTCCCCTGCTAAGGGAGCATGCGGCTTATACCC |
Downstream region at tRNA end position |
aagatactga |
Secondary structure (Cloverleaf model) | >WENV170717798 Ser GCT t GCCA aagatactga G - C G - C A - T G - C A - T T - A G - C T A T C T C C C A A G A G | | | | | G G G C C G G A G G G C G | | + T T T A G G T T G A A CATGCGGCTTATACCCGCATC C - G T - A C - G C - G C - G C A T A G C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |