Sequence ID | >WENV170718047 |
Genome ID | LSQX01059330 |
Phylum/Class | [LSQX] anaerobic digester metagenome; 4 biogas reactors fed with cattle manure at either 37C or 55C with and without the addition |
Species | |
Start position on genome | 39023 |
End posion on genome | 39097 |
Amino Acid | Val |
Anticodon | CAC |
Upstream region at tRNA start position |
ctaccattga |
tRNA gene sequence |
GGGCGATTAGCTCAGTGGGAGAGCACTTCGTTCACACCGAAGGGGTCACTGGTTCAAATC |
Downstream region at tRNA end position |
ccaacctcga |
Secondary structure (Cloverleaf model) | >WENV170718047 Val CAC a ACCA ccaacctcga G - C G - C G - C C - G G - C A - T T - A T A T T G A C C A G A A | | | | | A T C T C G A C T G G C G | | | | T T G G A G C G A A GGGTC C - G T - A T - A C - G G - C T C T A C A C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |