Sequence ID | >WENV170718362 |
Genome ID | LSQX01072482 |
Phylum/Class | [LSQX] anaerobic digester metagenome; 4 biogas reactors fed with cattle manure at either 37C or 55C with and without the addition |
Species | |
Start position on genome | 55747 |
End posion on genome | 55672 |
Amino Acid | Thr |
Anticodon | TGT |
Upstream region at tRNA start position |
cgaaagctgt |
tRNA gene sequence |
GCTGGTGTAGCTCAGCCGGTAGAGCAGCTGATTTGTAATCAGCAGGTCGGGGGTTCGAGT |
Downstream region at tRNA end position |
attaaaacgg |
Secondary structure (Cloverleaf model) | >WENV170718362 Thr TGT t TCCA attaaaacgg G - C C - G T - A G - C G - C T - A G - C T G T C T G C C A C G A A | + | | G C C T C G G G G G G C G | | | | T T G G A G C T A A AGGTC G - C C - G T - A G - C A - T T A T A T G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |