Sequence ID | >WENV170718411 |
Genome ID | LSQX01074624 |
Phylum/Class | [LSQX] anaerobic digester metagenome; 4 biogas reactors fed with cattle manure at either 37C or 55C with and without the addition |
Species | |
Start position on genome | 3438 |
End posion on genome | 3509 |
Amino Acid | Cys |
Anticodon | GCA |
Upstream region at tRNA start position |
aacacggctt |
tRNA gene sequence |
GCCAAGGTGGCGGAGCGGCTACGCGGTTGACTGCAGATCAACTCCACCCCGGTTCAAATC |
Downstream region at tRNA end position |
atccgatccc |
Secondary structure (Cloverleaf model) | >WENV170718411 Cys GCA t Ttcc atccgatccc G - C C - G C - G A - T A - T G - C G - C T A T G G G C C A G A G | | | | | A C G G C G C C C G G C G | | | T T G A C G C C T G TCCAC G - C T - A T - A G - C A - T C A T G G C A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |