Sequence ID | >WENV170718518 |
Genome ID | LSQX01079297 |
Phylum/Class | [LSQX] anaerobic digester metagenome; 4 biogas reactors fed with cattle manure at either 37C or 55C with and without the addition |
Species | |
Start position on genome | 4472 |
End posion on genome | 4388 |
Amino Acid | Leu |
Anticodon | TAA |
Upstream region at tRNA start position |
ctcctctcgc |
tRNA gene sequence |
GCGAGGGTAGCCAAGCCAGGCCAAAGGCGGTGGACTTAAGATCCACTCCCAAAGGGGTCC |
Downstream region at tRNA end position |
tttccttcgg |
Secondary structure (Cloverleaf model) | >WENV170718518 Leu TAA c Attc tttccttcgg G - C C - G G - C A - T G - C G - C G - C T A T T A C C C A C C G A A + | | | | G A A C C G G T G G G C G | | | T T G A G G C C C A A G TCCCAAAGGGGTCC G - C T - A G - C G - C A - T C A T G T A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |