Sequence ID | >WENV170718588 |
Genome ID | LSQX01082539 |
Phylum/Class | [LSQX] anaerobic digester metagenome; 4 biogas reactors fed with cattle manure at either 37C or 55C with and without the addition |
Species | |
Start position on genome | 18370 |
End posion on genome | 18454 |
Amino Acid | Leu |
Anticodon | GAG |
Upstream region at tRNA start position |
tcttccccgg |
tRNA gene sequence |
GCGAGGGTTGCCGAGCCAGGTCAAAGGCGCAAGGTTGAGGGCCTTGTCACGCAGGTGTTC |
Downstream region at tRNA end position |
gttttctcgg |
Secondary structure (Cloverleaf model) | >WENV170718588 Leu GAG g Attt gttttctcgg G - C C - G G - C A - T G - C G - C G - C T A T C T C G C A C C G A T | | | | | A A G C C G G A G C G C G | | | T T G A G G C T C A A G TCACGCAGGTGTTC C - G A - T A - T G - C G - C T G T G G A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |