Sequence ID | >WENV170718698 |
Genome ID | LSQX01087249 |
Phylum/Class | [LSQX] anaerobic digester metagenome; 4 biogas reactors fed with cattle manure at either 37C or 55C with and without the addition |
Species | |
Start position on genome | 1796 |
End posion on genome | 1869 |
Amino Acid | Cys |
Anticodon | GCA |
Upstream region at tRNA start position |
tctcttgcgt |
tRNA gene sequence |
GGCGGCATAGCCAAGCGGTAAGGCAGAGGACTGCAAATCCTCCATCCCCAGTTCGAATCT |
Downstream region at tRNA end position |
taataattta |
Secondary structure (Cloverleaf model) | >WENV170718698 Cys GCA t TCCA taataattta G - C G - C C - G G - C G - C C - G A - T T A T G G G T C A G A A | | | | | G C A C C G C C C A G C G | | | T T G A G G C T A A CATC G - C A - T G - C G - C A - T C A T A G C A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |