Sequence ID | >WENV170718700 |
Genome ID | LSQX01087281 |
Phylum/Class | [LSQX] anaerobic digester metagenome; 4 biogas reactors fed with cattle manure at either 37C or 55C with and without the addition |
Species | |
Start position on genome | 727 |
End posion on genome | 812 |
Amino Acid | Ser |
Anticodon | CGA |
Upstream region at tRNA start position |
ctgattcttt |
tRNA gene sequence |
GCCGAGGTAGTCTAGTCCGGGAAGGCGGTGGCCTCGAAAGCCACTGGTGTTCGGCACCTC |
Downstream region at tRNA end position |
taccacaacc |
Secondary structure (Cloverleaf model) | >WENV170718700 Ser CGA t GCtt taccacaacc G - C C - G C - G G - C A - T G - C G - C T A T C C C T C A T G A A | | | | | A C T C T G G G G A G C C | | + | T T G A G G C G G A G TGGTGTTCGGCACCTC G - C T - A G - C G - C C - G C A T A C G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |