Sequence ID | >WENV170718722 |
Genome ID | LSQX01088206 |
Phylum/Class | [LSQX] anaerobic digester metagenome; 4 biogas reactors fed with cattle manure at either 37C or 55C with and without the addition |
Species | |
Start position on genome | 5563 |
End posion on genome | 5649 |
Amino Acid | Ser |
Anticodon | TGA |
Upstream region at tRNA start position |
atttcaataT |
tRNA gene sequence |
GCTGAGGTAGCCAAGCGGACCACGGCGCCGGTCTTGAAAACCGGTAGCGCTACGCGCTAC |
Downstream region at tRNA end position |
ctttcttttt |
Secondary structure (Cloverleaf model) | >WENV170718722 Ser TGA T GTaa ctttcttttt G - C C - G T - A G - C A - T G - C G - C T A T C T C T C A C G A A | + | | | G G A C C G G G G A G C G | | | T T A C G G C C C A G TAGCGCTACGCGCTAC C - G C - G G - C G - C T - A C A T A T G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |