Sequence ID | >WENV170719188 |
Genome ID | LSQX01104951 |
Phylum/Class | [LSQX] anaerobic digester metagenome; 4 biogas reactors fed with cattle manure at either 37C or 55C with and without the addition |
Species | |
Start position on genome | 42530 |
End posion on genome | 42619 |
Amino Acid | Ser |
Anticodon | GCT |
Upstream region at tRNA start position |
cgcagtctaa |
tRNA gene sequence |
GGAGAGATGGCCGAGTGGTCGAAGGCGCTCGCCTGCTAAGTGAGTGGGGCTTTGCCGCCC |
Downstream region at tRNA end position |
tttaatataa |
Secondary structure (Cloverleaf model) | >WENV170719188 Ser GCT a GCCA tttaatataa G - C G - C A - T G - C A - T G - C A - T T A T C T C C C A T G A G | | | | | G G G C C G G A G G G C G | | | T T T A G G C C G A G TGGGGCTTTGCCGCCCCC C - G T - A C - G G + T C - G C A T A G C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |