Sequence ID | >WENV170719191 |
Genome ID | LSQX01104951 |
Phylum/Class | [LSQX] anaerobic digester metagenome; 4 biogas reactors fed with cattle manure at either 37C or 55C with and without the addition |
Species | |
Start position on genome | 79672 |
End posion on genome | 79759 |
Amino Acid | Ser |
Anticodon | GGA |
Upstream region at tRNA start position |
ttgccgatag |
tRNA gene sequence |
GGAGAAGTGGCCGAGTGGTCGAAGGCGGGCGCTTGGAGAGCGTCTGAACCGCGAGGTTCC |
Downstream region at tRNA end position |
tgaatattaa |
Secondary structure (Cloverleaf model) | >WENV170719191 Ser GGA g GCCA tgaatattaa G - C G - C A - T G - C A - T A - T G - C T A T C A C T C A T G A G | | | | | G G G C C G G T G A G C G | | | T T T A G G C C G A G TGAACCGCGAGGTTCC G - C G + T C - G G - C C - G T A T G G G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |