Sequence ID | >WENV170719193 |
Genome ID | LSQX01104951 |
Phylum/Class | [LSQX] anaerobic digester metagenome; 4 biogas reactors fed with cattle manure at either 37C or 55C with and without the addition |
Species | |
Start position on genome | 265137 |
End posion on genome | 265212 |
Amino Acid | Arg |
Anticodon | CCT |
Upstream region at tRNA start position |
cgtcccgagc |
tRNA gene sequence |
GGGCCTGTAGCTCAGGGGATAGAGCAACGGCCTCCTAAGCCGTAGGTCGGCCGTTCGAAT |
Downstream region at tRNA end position |
tattattgtc |
Secondary structure (Cloverleaf model) | >WENV170719193 Arg CCT c GCCA tattattgtc G - C G - C G + T C - G C - G T - A G - C T A T C C G G C A G G A A | | | | | G G C T C G G G C C G C G | | | | T T A G A G C T A A AGGTC A - T C - G G - C G - C C - G C A T A C C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |